Facility J [Drop Contents] - "Dei Sub Numine Viget"

ignatzmouse · Post by **ignatzmouse** » Wed Mar 21, 2007 10:20 pm

ShardinsKitten wrote:Walter updated his profile to say

It is tough being an Octalgenarian. You kids may be young now, but you will eventually Convert to be like me, no matter how Plain you start.
Jane took IKYOIYK and converted it to Octal to get :

111113131117111131113

Which lead to if (a=1) the sequence:

aaa aac aca aag aaa aca aac

OMG! Hooray for Jane! Yipee!

"THE CURE" it is.

janesalteredstates · Post by **janesalteredstates** » Wed Mar 21, 2007 10:21 pm

trainer101 wrote:If we have participated in the destruction of "The Cure". then the question now is - Who's side is Walter really on?

Yup. Not sure what "The Cure" references. Could be the evil name for whatever it is they were working on. Like, "curing the world of men."

blahblablee · Post by **blahblablee** » Wed Mar 21, 2007 10:23 pm

trainer101 wrote:
Ziola wrote:
blahblablee wrote: Isn't it obvious...

The Order

Stupid double crossing old fart...

I just knew you'd be right around the corner.

So, Walter works for OpA... wonder what Traveler J's association is?

IDK we're now having a ...sorta... discussion about this...and a lot of good points are being raised..

For example:
Why would they be on the run?

Edit: PS:

I'm always around the cornor....cause I'm awesome like that...

TOSG · Post by **TOSG** » Wed Mar 21, 2007 10:24 pm

GREAT work!

I'm bummed that my computer crapped out right before you guys figured it out.

On that note, I was only running the chat and itunes when it died, and it seems to have been a pretty serious crash, so I'm afraid that I'm going to have to keep out of the chat until I know what's going on.

So, if you guys have any other big breakthroughs, please post them here!

blahblablee · Post by **blahblablee** » Wed Mar 21, 2007 10:25 pm

TOSG wrote:GREAT work!

I'm bummed that my computer crapped out right before you guys figured it out.

On that note, I was only running the chat and itunes when it died, and it seems to have been a pretty serious crash, so I'm afraid that I'm going to have to keep out of the chat until I know what's going on.

So, if you guys have any other big breakthroughs, please post them here!

Hope ur comp gets better

...

We'll keep u updated

Ziola · Post by **Ziola** » Wed Mar 21, 2007 10:26 pm

trainer101 wrote:
Ziola wrote:
blahblablee wrote: Isn't it obvious...

The Order

Stupid double crossing old fart...

I just knew you'd be right around the corner.

So, Walter works for OpA... wonder what Traveler J's association is?

Now, now...would you rather Op's loveliest agent wasn't around?

Great job guys

Luminous · Post by **Luminous** » Wed Mar 21, 2007 10:29 pm

TOSG wrote:GREAT work!

I'm bummed that my computer crapped out right before you guys figured it out.

On that note, I was only running the chat and itunes when it died, and it seems to have been a pretty serious crash, so I'm afraid that I'm going to have to keep out of the chat until I know what's going on.

So, if you guys have any other big breakthroughs, please post them here!

Ohh... Sorry to hear that TOSG. Hope you get it sorted out soon.

Luminous · Post by **Luminous** » Wed Mar 21, 2007 10:32 pm

janesalteredstates wrote: <-- blushing
<-- actually in shock

thank you.

So, i sent a message to Walter asking him about "The Cure." Now we wait, I guess.

Yay Jane! Congratulations! Good Work!

trainer101 · Post by **trainer101** » Wed Mar 21, 2007 10:43 pm

Ziola wrote:Now, now...would you rather Op's loveliest agent wasn't around?

Of course not! It's always fun to play with the bad girls!

ShardinsKitten · Post by **ShardinsKitten** » Wed Mar 21, 2007 11:16 pm

Here is a better break down of how we got from the letters to octal for those curious is the mechanics of it, from FiremanDan aka Shardin:

[22:10] <Shardin> IKYOIYK
[22:10] <Shardin> ASCII Decimal Octal
[22:10] <Shardin> I = 73 = 111
[22:10] <Shardin> K = 75 = 113
[22:10] <Shardin> Y = 89 = 131
[22:10] <Shardin> O = 79 = 117
[22:10] <Shardin> I = 73 = 111
[22:10] <Shardin> Y = 89 = 131
[22:10] <Shardin> K = 75 = 113
[22:10] <Shardin>
[22:10] <Shardin> I K Y O I Y K
[22:10] <Shardin> 111 113 131 117 111 131 113
[22:10] <Shardin>
[22:10] <Shardin> 111113131117111131113
[22:10] <Shardin> aaaaacacaaagaaaacaaac

deagol · Post by **deagol** » Wed Mar 21, 2007 11:18 pm

Awesome Jane! nice "state" you pulled off there

I feel so stupid, I explained to trainer in detail how I decoded one of "We Are The D" ...er, dehteraew codes from octal ascii just a few weeks ago. Durnit.

Just to show all the steps:

Code: Select all

IKYOIYK
111 113 131 117 111 131 113 (octal ascii)
aaa aac aca aag aaa aca aac (1=a, 3=c, 7=g)
K N T K K T N (aminoacid codes)
Lysine_Asparagine_Threonine_Lysine_Lysine_Threonine_Asparagine (aminoacid names)
1        3            5       3         6  2              7    (number code)
LPOSEHG
+8 -8 +16 -16 +16 -16 +24 (shifts)
THECURE

So, is it the cure for XSCID? And, why is Walter making us destroy it?

ignatzmouse · Post by **ignatzmouse** » Thu Mar 22, 2007 7:16 am

janesalteredstates wrote:
trainer101 wrote:If we have participated in the destruction of "The Cure". then the question now is - Who's side is Walter really on?
Yup. Not sure what "The Cure" references. Could be the evil name for whatever it is they were working on. Like, "curing the world of men."

Oh yes, I like that. Sounds very "We know what's best for you, if you take your medicine Oppy will get you a candy."

ignatzmouse · Post by **ignatzmouse** » Thu Mar 22, 2007 7:26 am

So in retrospect this puzzle had a simple solution, I think the thing that bogged us down was the sidetrack into chemistry. I was sooo sure that IKYOIYK was Iodine_Potassium_etc and that ITIYETI was a good half-way solution.

Turns out that Walter just grabbed any old reference card with "8" on it, and the fact that I,K,O,Y are elements is pure coincidence (about a 1-in-12 coincidence). If Walter had grabbed pretty much any other card, I bet we'd have had this solution days ago.

Anyhow, we have the answer now, hooray! Hooray for Jane!

chershaytoute · Post by **chershaytoute** » Thu Mar 22, 2007 10:37 am

Wow!! I lurk and watch...and wish I could learn

...

And be impressed as heck with you folks...

And yay! you guys and yay! Jane (and notJane and all of herothers)

deagol · Post by **deagol** » Thu Mar 22, 2007 5:33 pm

ignatzmouse wrote:So in retrospect this puzzle had a simple solution, I think the thing that bogged us down was the sidetrack into chemistry. I was sooo sure that IKYOIYK was Iodine_Potassium_etc and that ITIYETI was a good half-way solution.

Turns out that Walter just grabbed any old reference card with "8" on it, and the fact that I,K,O,Y are elements is pure coincidence (about a 1-in-12 coincidence). If Walter had grabbed pretty much any other card, I bet we'd have had this solution days ago.

Anyhow, we have the answer now, hooray! Hooray for Jane!

Actually, he couldn't have avoided I, K, O, Y, given that he used octal ascii codes to make DNA, to make aminoacids.

Since t=20 can't be used as a base in the DNA sequence, and a=1 is required as a starting base in every triplet in order to form a valid 3-digit octal ascii code, these are the 9 remaining combinations available:

Code: Select all

aaa aca aga = 111 131 171 = I Y y
aac acc agc = 113 133 173 = K [ {
aag acg agg = 117 137 177 = O _ DEL

So, turns out the only letters available for his coding system were I, K, O, Y, and y, and their respective aminoacids, K N K T R. If he didn't want to use that lowercase y that leaves only three aminoacids: lysine, asparagine, and threonine. The available letters from those are: aeghilnoprsty.

Limiting the shifts to +/- 8 or 16, and even excluding any wrapping (-):

Code: Select all

 +0:aeghilnoprsty
 +8:imopqtvwxz---
+16:quwxy--------
 -8:----adfghjklq
-16:---------bcdi

Which shows how Walter did have every letter to chose from for his message, even after all those constraints, so he didn't really need that +24 shift, nor wrapping around z or a!