Traveler J - "Catalyst (Find Him)" [02/08/2007]

Infiltrate the Order and explore the very foundations of this secret organization.

Moderator: Moderators

User avatar
Luminous
Thor's Hammer
Posts: 1341
Joined: Sun Nov 26, 2006 1:18 am
Location: Facility J
Contact:

Post by Luminous »

Here are screen caps with the letters/symbols from the leader to the video. Without my video software, it's difficult for me to tell if they are in the right sequence, or if I got all of them. I had to catch these by the click play button / screen cap method:

Image

Image

Image

Image

and these three images janesalteredstates captured from the end:

Image

Image

Image

I'm also wondering if the number of rectangles/lines at the beginning might mean something as well?
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
User avatar
McPackage
Casual Observer
Posts: 76
Joined: Mon Jan 22, 2007 5:13 pm
Location: California
Contact:

Post by McPackage »

The video is on revver too, which lets you download the video directly.

http://one.revver.com/watch/179933

Download and view in quicktime. You can advance frame-by-frame with the left-right arrow keys while the video is paused.
User avatar
McPackage
Casual Observer
Posts: 76
Joined: Mon Jan 22, 2007 5:13 pm
Location: California
Contact:

Post by McPackage »

Walter updated his myspace profile:
You kids still haven't found my full name? I'm not entirely surprised. You act as if I gave you a chiffre indéchiffrable.
User avatar
Luminous
Thor's Hammer
Posts: 1341
Joined: Sun Nov 26, 2006 1:18 am
Location: Facility J
Contact:

Post by Luminous »

McPackage wrote:Walter updated his myspace profile:
You kids still haven't found my full name? I'm not entirely surprised. You act as if I gave you a chiffre indéchiffrable.
:lol:

Well, I'm a beginner at this stuff, and I've gone as far as I can go. (until I get me video software running and I can disect the the video frame by frame. I have another week or so to go on that. I had a malware attack that mucked up my registry. For some reason the only thing it really damaged was my video editing program.) I tried looking at it in quicktime, but it still doesn't give me the control I need to make sure I'm seeing everything that needs to be seen. I suspect there may be some counting we need to do. If that's the case, we need to see everything that is there.

I tried my hand at decoding the cyper, with no luck. I just don't know enough about what I'm doing :(

But now that Walter is talking to us, maybe he'll give us some hints I can understand.
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
User avatar
theslyestfox
Casual Observer
Posts: 44
Joined: Tue Jan 09, 2007 3:20 am
Location: B.C., Canada
Contact:

Post by theslyestfox »

McPackage wrote:Walter updated his myspace profile:
You kids still haven't found my full name? I'm not entirely surprised. You act as if I gave you a chiffre indéchiffrable.

when i googled "chiffre indéchiffrable" i got :
http://en.wikipedia.org/wiki/Vigen%C3%A8re_cipher

so it looks like Luminous was right:
Luminous wrote:
theresascraps wrote:I am going to write down the words and try to rearrange them so i can see if they form some wort of words, but there are almost too many wierd consonants and vowels are wrong....


theresa
I agree. That's why I haven't even gone there. I'm wondering if it might be a vigenere cipher:

http://en.wikipedia.org/wiki/Vigen%C3%A8re_cipher

If so, what would the key be?

Also, if it's not a vigenere cipher, I wonder what sort of code might use the numbers 11226( 8 ) as a key?
so i bet if we can make it it'll give us his last name! sadly i have little to no clue how to so such a thing....i leave it to you who do!
Let's prove science wrong for the rest of our lives!!!


http://www.youtube.com/theslyestfox
User avatar
Luminous
Thor's Hammer
Posts: 1341
Joined: Sun Nov 26, 2006 1:18 am
Location: Facility J
Contact:

Post by Luminous »

Ok, I realize this is very basic for a lot of people here, but it's a stiff learning curve for me.

From a pointer Trainer had given me, I knew the stamp on the telegram was a cipher, but with no experience, I had no idea what kind.

Walter's comment "You act as if I gave you a chiffre indéchiffrable". Lead me here:

http://en.wikipedia.org/wiki/Vigen%C3%A8re_cipher

So now I know we have a vigenere cipher, but in order to crack it we need to know what the key is. I'm sure it's right in front of me, but I'm just not seeing it yet. :smt101
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
User avatar
theslyestfox
Casual Observer
Posts: 44
Joined: Tue Jan 09, 2007 3:20 am
Location: B.C., Canada
Contact:

Post by theslyestfox »

Luminous wrote:Ok, I realize this is very basic for a lot of people here, but it's a stiff learning curve for me.

From a pointer Trainer had given me, I knew the stamp on the telegram was a cipher, but with no experience, I had no idea what kind.

Walter's comment "You act as if I gave you a chiffre indéchiffrable". Lead me here:

http://en.wikipedia.org/wiki/Vigen%C3%A8re_cipher

So now I know we have a vigenere cipher, but in order to crack it we need to know what the key is. I'm sure it's right in front of me, but I'm just not seeing it yet. :smt101
*laughs* we posted at almost exactly the same time!!! :lol:
Let's prove science wrong for the rest of our lives!!!


http://www.youtube.com/theslyestfox
User avatar
Luminous
Thor's Hammer
Posts: 1341
Joined: Sun Nov 26, 2006 1:18 am
Location: Facility J
Contact:

Post by Luminous »

I noticed that :lol: Any ideas on what the key word might be? I'm thinking of trying walter

edit: Here is a tool Trainer101 pointed me to for decoding cyphers. I have been playing with it, but no luck yet :roll:

http://rumkin.com/tools/cipher/
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
theresascraps
Lonely Fan
Posts: 178
Joined: Wed Feb 14, 2007 11:21 am
Location: arizona

Post by theresascraps »

Well there could be so many keywords here....I mean, DNA, RNA, embryo, research, genes...All could be possiblities. I agree about the learning curve. I am working on learning it myself....i think you are right thought, i think this jumble of letters will give us a last name...

theresa
User avatar
Luminous
Thor's Hammer
Posts: 1341
Joined: Sun Nov 26, 2006 1:18 am
Location: Facility J
Contact:

Post by Luminous »

I tried walter, and it didn't work, but then again I don't know what I'm doing. I'm using the rumkin cipher tool, but there are so many possibilities, I'm not sure where to start. I tried using the first 27 letters of the DNA sequence, since there are 27 letters in the cipher. I also tried using the inverse and the complement, of 27 letters from both ends of the sequence, since Walter said we have to "shift our perspective on the sequence that got us here" I have a hunch the key is in something we have decoded. I wish I knew more about what I'm looking for and how to use it when I find it :?

The rumkin cipher tool offers three options for deciphering a viginere cypher:

1.) The standard vigener cipher, which asks only for a pass phrase. I'm not sure what makes up a good pass phrase. I think it can be any length, although it must repeat to equal the number of letters in the phrase you are deciphering.

2.) Then there is a keyed vigener cipher which asks for an alphabet key in addition to a passphrase. I'm not sure what the difference is between a key and a passphrase, how they work and how to know the difference when you are trying to find them.

3.) It also as an Autokeyed option that wants a passphrase. I have know idea what that means or how it's different than the other two. It seems that maybe it's a tool used for encryption rather than decryption, yet is has a decrypt option :?

There are so many variations on vigener ciphers and their potential keys and passphrases it makes my head swim.

I know walter has given us what we need. There has to be a smart, easy way to solve this.

Hmmmmmm. Still thinking. :smt017 :-k
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
User avatar
TOSG
Devoted Fan
Posts: 620
Joined: Thu Sep 14, 2006 4:54 pm

Post by TOSG »

I tried a few things, but couldn't make any headway. Perhaps we should solicit some help from people in the OpAphid section; they seem to be brilliant at figuring out these sorts of things.
User avatar
Luminous
Thor's Hammer
Posts: 1341
Joined: Sun Nov 26, 2006 1:18 am
Location: Facility J
Contact:

Post by Luminous »

I wish they would help, but I think they might be taking some sadistic pleasure in watching us thrash around with this :twisted: I'm sure any number of them could solve this in seconds.

In the mean time, I keep referring back to Walter's note.

Image

Especially the part that reads THE SECOND ENZYME WAS MORE SIGNIFICANT | I SUPPOSE IT IS TIME THAT I LET YOU KNOW MY FULL IDENTITY | TO FIND IT YOU WILL HAVE TO SHIFT YOUR PERSPECTIVE ON THE SEQUENCE THAT GOT YOU HERE

I can't help but think that these are somehow the keys to the cypher. When you play around with the DNA sequence is there a frame shift, that involves the Taqi enzyme that would give us a that is 27 letters long or shorter? Any thing that looks like it might be a passphrase for the cipher? I'm grasping at straws here, but for now it's the best I can do.

By the way, thanks for the message explaining what a frame shift is. It's helping me form my thinking around solving this puzzle. I also remember at one time you said the STOP's might be important as well, maybe somehow referencing stop codon's?
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
User avatar
TOSG
Devoted Fan
Posts: 620
Joined: Thu Sep 14, 2006 4:54 pm

Post by TOSG »

Luminous wrote:When you play around with the DNA sequence is there a frame shift, that involves the Taqi enzyme that would give us a that is 27 letters long or shorter? Any thing that looks like it might be a passphrase for the cipher? I'm grasping at straws here, but for now it's the best I can do.
Nothing that I can think of, sorry.
Luminous wrote: By the way, thanks for the message explaining what a frame shift is. It's helping me form my thinking around solving this puzzle. I also remember at one time you said the STOP's might be important as well, maybe somehow referencing stop codon's?
Yep, that was my thought, although I'm not sure if it pans out at all.
User avatar
Luminous
Thor's Hammer
Posts: 1341
Joined: Sun Nov 26, 2006 1:18 am
Location: Facility J
Contact:

Post by Luminous »

Something I Found on Wikipedia that I think might be pertinent:

Frameshift mutation

A frameshift mutation (also called a frameshift or a framing error) is a genetic mutation that inserts or deletes a number of nucleotides that is not evenly divisible by three from a DNA sequence. Due to the triplet nature of gene expression by codons, the insertion or deletion can disrupt the reading frame, or the grouping of the codons, resulting in a completely different translation from the original. The earlier in the sequence the deletion or insertion occurs, the more altered the protein produced is.

A frameshift mutation causes the reading of codons to be different, so all codons after the mutation (with a few exceptions due to redundancy) will code for different amino acids. Furthermore, the stop codon "UAA, UGA, or UAG" will not be read, or a stop codon could be created at an earlier site. The protein being created could be abnormally short, (maybe 27 letters or shorter?) abnormally long, and/or contain the wrong amino acids. It will most likely not be functional.

EDIT: The more I contemplate this the more it makes sense to me that this is what we are looking for. I think we have to rework the DNA sequence before the cipher can be cracked.
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Weepel
Suspiciously Absent
Posts: 16
Joined: Tue Jan 30, 2007 9:13 pm

Post by Weepel »

Luminous wrote:TO FIND IT YOU WILL HAVE TO SHIFT YOUR PERSPECTIVE ON THE SEQUENCE THAT GOT YOU HERE
It seems to me that the idea ist o take the DNA sequence that was decoded and then use that as a new coded message in a vigenere cipher (which is just a bunch of shifts http://en.wikipedia.org/wiki/Vigen%C3%A8re_cipher). I think its just a matter of finding the key and applying it to: cgacatatgagcatggcgaccagcaccttcagtgcgcagtgtggcccggagcatcattacctggctgaa
cattcttctatttttaatggcgtcttcagccagcagcttaaaaacaaccttatctactttccctcctcctactttccctcctcccgcttgagggtaggccccatcccccccttt
Post Reply