It's amazing, and even a bit frustrating, to see how close we got at some points:
All the way back from the first page, a week ago:
Luminous wrote:So here's what we've tried so far in chat:
...
Message: ijoopyaattzbqkipyerggjqa
Pass: Everymanandeverywomanisastar
Result: eokxrmantgwxvgrrcqfgtbya
...
Grrr... just one more time Lum!
The next day:
ignatzmouse wrote:OK, next bit of cryptanalysis that doesn't get us a result...
...
Code: Select all
a ijoopyaattzbqkipyerggjqa
c ghmmnwyyrrxzoignwcpeehoy
g cdiijsuunntvkecjsylaadku
t pqvvwfhhaagixrpwflynnqxh
And there's the right key, of course:
Code: Select all
k iqiiwyaaaagiqiiwscyaaqka
s atggtaaattttacatgctggtga
iMouse got real close when using my decoding table:
ignatzmouse wrote:Trying
the shifting trick on deagol's block:
...
Code: Select all
a:srmmlcaahhbzkqslcwjuurka
c:utooneccjjdbmsuneylwwtmc
g:yxssriggnnhfqwyricpaaxqg
t:lkffevttaausdjlevpcnnkdt
a:srmmlcaahhbzkqslcwjuurka
c:utooneccjjdbmsuneylwwtmc
g:yxssriggnnhfqwyricpaaxqg
t:lkffevttaausdjlevpcnnkdt
sksseeccaa---
and indeed the encryption key "sksseeccaab" produces the output "atggtcccttatacatcgtggkik". But I doubt this is our secret star.
Compare:
Code: Select all
what you got: sksseeccaabsksseeccaabsk
the real key: skssecaaaausksseiycaakqa
output: atggtcccttatacatcgtggkik
solutn: atggtaaattttacatgctggtga
^^^^^ ^^ ^^^^^ ^^^
15/24 (>62%) bases correct.
Reason for the length-11 false key (iMouse already mentioned this but using the iqiiwy key, and I thought in plain english would be clearer):
Code: Select all
everymanandeverywomanisa
everymanandeverywomanisa
^^^^^ ^^
A bit later, Lum always asking the right questions:
Luminous wrote:...
ATG = M - Start codon - so that makes sense.
...
KIK = ?
...
1. What would it take to turn KIK into a stop codon to balance the ATG start codon, and how would that affect the rest of the sequence?
And:
Luminous wrote:Seems like the problem is that the frequency of the phrase/key don't match to produce a sequence of codons - hope this analysis is correct.
This makes me wonder - If Jay wanted to mask the frequency in order to make things more challenging to decode, what kind of strategies might he use? Sorry I don't have any answer for this - I'm better at coming up with questions lol
D'oh, double-bag it!
Luminous wrote:If it were a one time pad though, it seems like he would find a way to provide the key. In the past the key has always been provided. I can't imagine we would be expected to guess it - at least I would hope not

It's almost like getting help from Jay himself!
Lum & Kit:
ShardinsKitten wrote:heh maybe cuz I never hear it lol
[17:31] <@LumBack> K, so what I was thinking about the puzzle.
[17:31] <@LumBack> I was thinking that the Crowley references identify the keys
[17:31] <@LumBack> and that the ijoopy . . . . is the message text
[17:32] <@LumBack> cause it syncs mathmatically with the decrypt numbers.
[17:32] <@LumBack> either 4 to each #(+#)
[17:32] <@LumBack> or three to the #'s with a start and stop codon.
[17:33] <@LumBack> So, hang on, I'm getting something.
[17:34] <@LumBack> So when we use Every man and every woman is a star
[17:34] <@LumBack> to decrypt ijoopyaattzbqkipyerggjqa
[17:34] <@LumBack> we get eokxrmantgwxvgrrcqfgtbya
[17:34] <@LumBack> Which is, as best we can tell, nonsense.
[17:35] <@LumBack> So I was looking at that and wondering
[17:35] <@LumBack> If Jay wanted to make a harder puzzle
[17:35] <@LumBack> so Deag and Mouse couldn't just crack it immediately
[17:35] <@LumBack> how would he mask the sequence
[17:35] <@LumBack> so they couldn't force decrypt it?
[17:36] <@SultryKitten> so you think we need to decrypt that again with the other crowely thing?
[17:36] <@LumBack> Anyway, that's as far as I got
in case someone can finish before I get the chance to tonight.
We were thinking maybe we need to decrypt it again with our second crowely hint.
Holy sh*t, why didn't you! I would've been able to sleep soundly last night, instead of waking up at 3 am screaming "iterate, irate!", and then iterating 6 times in the wrong direction, and with interspersed rot13 chars... grrr!
I'm now convinced Lum's behind this gamejack!
