Posted: Sat May 12, 2007 9:43 pm
Last Login: 9 minutes ago

Forum to post messages about Bree and Danielbeast
https://lg15.cassieiswatching.com/forum/
https://lg15.cassieiswatching.com/forum/viewtopic.php?t=9926
And the reply:ignatzmouse wrote:OK, I sent:Lame "TGAC?" meaning give us a hint whether it's an encrypted DNA sequence we're looking for. We shall see if we get a reply.ignatzmouse wrote: To: JayNineteen
Sent: May 12, 2007
Read: —
Subject: ijoopyaattzbqkipyerggjqa
Message:
The volunteer corps has been going crazy over your profile.
Going crazy, I say crazeeeee!
All attempts at decryption have gone nowhere.
Can you give us a hint?
?
JayNineteen wrote:Sent: May 12, 2007
Subject: Re: ijoopyaattzbqkipyerggjqa
Message:
iterate
Done!ShardinsKitten wrote:mouse I dunno if you did this already, but when you get a response would you mind posting both of them in the archive of messages too please.
hmmmit·er·ate /ˈɪtəˌreɪt/ Pronunciation Key - Show Spelled Pronunciation[it-uh-reyt] Pronunciation Key - Show IPA Pronunciation verb, -at·ed, -at·ing.
–verb (used with object)
1. to utter again or repeatedly.
2. to do (something) over again or repeatedly.
–verb (used without object)
3. to operate or be applied repeatedly, as a linguistic rule or mathematical formula.
[Origin: 1525–35; < L iterātus, ptp. of iterāre to repeat, equiv. to iter- (s. of iterum) again + -ātus -ate1]
in case someone can finish before I get the chance to tonight.[17:31] <@LumBack> K, so what I was thinking about the puzzle.
[17:31] <@LumBack> I was thinking that the Crowley references identify the keys
[17:31] <@LumBack> and that the ijoopy . . . . is the message text
[17:32] <@LumBack> cause it syncs mathmatically with the decrypt numbers.
[17:32] <@LumBack> either 4 to each #(+#)
[17:32] <@LumBack> or three to the #'s with a start and stop codon.
[17:33] <@LumBack> So, hang on, I'm getting something.
[17:34] <@LumBack> So when we use Every man and every woman is a star
[17:34] <@LumBack> to decrypt ijoopyaattzbqkipyerggjqa
[17:34] <@LumBack> we get eokxrmantgwxvgrrcqfgtbya
[17:34] <@LumBack> Which is, as best we can tell, nonsense.
[17:35] <@LumBack> So I was looking at that and wondering
[17:35] <@LumBack> If Jay wanted to make a harder puzzle
[17:35] <@LumBack> so Deag and Mouse couldn't just crack it immediately
[17:35] <@LumBack> how would he mask the sequence
[17:35] <@LumBack> so they couldn't force decrypt it?
[17:36] <@SultryKitten> so you think we need to decrypt that again with the other crowely thing?
[17:36] <@LumBack> Anyway, that's as far as I got
ignatzmouse wrote:Iterate is indeed a standard computer science term.
Most likely a red herring, but one of its uses comes from regular expressions, where "repeat X zero or more times" is written "X*", and pronounced "X star". Hmm. This use of "star" is also called "Kleene closure".
Code: Select all
key := ijoopyaattzbqkipyerggjqa
msg := everymanandeverywomanisa
FOR iteration = 1 TO 6
msg := encrypt (msg, key)
print (iteration+":"+msg)
ENDFOR
Output:
1:mesfnkantgcfloznusdgtria
2:ungtcianmzbgbyhcswumzaya
3:cwuhrganfsahriprqalsfjoa
4:kfivgeanylzihsxgoecylsea
5:sowjvcanreyjxcfvmiterbua
6:axkxkaankxxknmnkkmkkxkka
Bingo.deagol wrote:Not sure if this is progress. This is in pseudocode in the hope that more people can follow:
What I'm doing is just feeding the result back as the input message on the encryption machine (that's how I interpret the 'iterate' hint), starting with the "Every man and..." text.Code: Select all
key := ijoopyaattzbqkipyerggjqa msg := everymanandeverywomanisa FOR iteration = 1 TO 6 msg := encrypt (msg, key) print (iteration+":"+msg) ENDFOR Output: 1:mesfnkantgcfloznusdgtria 2:ungtcianmzbgbyhcswumzaya 3:cwuhrganfsahriprqalsfjoa 4:kfivgeanylzihsxgoecylsea 5:sowjvcanreyjxcfvmiterbua 6:axkxkaankxxknmnkkmkkxkka
Code: Select all
key := everymanandeverywomanisa
msg := ijoopyaattzbqkipyerggjqa
FOR iteration = 1 TO 2
msg := decrypt (msg, key)
print (iteration+":"+msg)
ENDFOR
Output:
1:eokxrmantgwxvgrrcqfgtbya
2:atggtaaattttacatgctggtga
Anyone want to try this as a myspace last name?(Start)VECTOR(Stop)