Lonelygirl15

I like this guy. He's like an old dude who lives across the street.
"Hey you kids! Get off of my lawn!"

Ok, sorry. This info is of the utmost importance to me. I must sleep. My days are long, and full. Tomorrow I will crack codes and what-have-you.
I apologize for not being of any real help right now.

Meanwhile, is there some place I can look to find out what we have so far? Like I said, I've been terribly busy.

It looks like there may be some clues in the video. I'm working on extracting them.

I think I got it. A solution, knock on wood, should be forthcoming within an hour.

Here is a sample of the kind of thing I am seeing in the video that I think might be a clue. There are more of these:



It almost looks like a chalkboard diagram to me.

Sorry Janes, we don't have much yet. Just what you see here in this thread.

TOSG wrote:I think I got it. A solution, knock on wood, should be forthcoming within an hour.

(the J team)

Here's another image:



There is a mark that looks like a sideways S that is partially covered by the solid box that the number is in. This same (or similar) mark appears at least one other place in the video, only it is completely visible.

The hidden message is this:

"I had new hope after meeting her. I had my reels back. Three Three R Five Nine P"

Leads to http://tinyurl.com/33R59P

I'll explain how I got it in a few. It was, indeed, pretty hard.

Good job TOSG! You knocked that one down - excuse the pun

Based on that message it looks like you have more work to do to "shift your perspective on the sequence that got you here."

Okay, here's my explanation. I wish that I had some brilliant, razor-like solution, but I'm afraid that I just used logic and persistence, with a few guiding principles.

1) Looking at a BLAST (http://130.14.29.110/BLAST/ ; look at "nblast") alignment of the sequence, I saw that there were three large regions of human DNA, and two regions of DNA sequence that did not match with any known DNA source.

2) So, I hypothesized, as before, that the unmatched DNA was likely where the message was encoded (as Walter could have free reign to encode any message he liked there, rather than being constrained to a given sequence of human DNA).

3) Thus, I manually removed most of the regions that had homology with the human DNA, so I could focus on the (in my estimation) important part of the sequence.

4) So, I made a restriction map of this sequence (on the NEBCutter 2.0 program), showing all the restriction enzymes that cut the sequence.

5) I noticed that BamHI was a double-cutter of this sequence (BamHI is a commonly used enzyme, so that tipped me off), and removed the rest of two of the human DNA regions. So, I cut the DNA with that.

6) I then looked at this fragment in NEBCutter, again.

7) Given the clue that TaqI might be used (see my previous post), I searched for that, and found that it cut three times.

I counted up that Walter had given instructions for decoding 61 letters, so I looked for a DNA fragment that was 61*3 = 183 bases long.

9) Awesome! I found that two of the TaqI cut sites combined to leave behind a 183-base pair sequence!

10) I put this sequence into a protein translator, and then grinded away at decoding the letters, according to the same principles as last time.

So, there you have it! Probably not the most elegant way to do it, but it worked, and pretty fast.

For the curious, the DNA sequence is: cgacatatgagcatggcgaccagcaccttcagtgcgcagtgtggcccggagcatcattacctggctgaa
cattcttctatttttaatggcgtcttcagccagcagcttaaaaacaaccttatctactttccctcctcctactttccctcctcccgcttgagggtaggccccatcccccccttt

And the protein sequence is: R H M S M A T S T F S A Q C G P E H H Y L A E H S S I F N G V F S Q Q L K N N L I Y F P S S Y F P S S R L R V G P I P P F

I cropped the stamp and the number on the upper right of the telegram, and enhanced the contrast a bit. Looks like they're probably clues:

Luminous wrote: Based on that message it looks like you have more work to do to "shift your perspective on the sequence that got you here."

Definitely. I think that I'm going to take a break for tonight, though .

The letters in the "postmark" type thing are probably significant, but they don't look like a protein sequence (the letter "J" does not represent any of the standard twenty amino acids).

Maybe it's an anagram of some sort?

EDIT: The red (partial) numbers in the top-right corner might also be worth looking at.

Good night. Great work you did there!

One last screen cap before I call it a night.



This appears close to the end.

Wow, i feel stupid now, i only found the obvious code. i know nothing about gene sequencing, English and philosophy degrees, you are amazing!!! This game is getting more fun. it is so exciting when you uncover the little clues and letters. I love it.

Great work!!! I too saw the chalkboard writing. My theory is that somehow they took the baby with the bowed legs and perhaps figured out how to straighten them genetically????Something with human research I suppose. There is more, but like i said I don't know how to switch up the DNA sequencing code. we will see what you come up with. You are great!!!

Theresa

Do you think the chalkboard letters might spell out Cassie? That they are perhaps related??

Theresa